ID: 1094840666

View in Genome Browser
Species Human (GRCh38)
Location 12:34341447-34341469
Sequence CCGGGTTCACGCCCCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094840649_1094840666 18 Left 1094840649 12:34341406-34341428 CCCCTGCCACGCATGCGCGGGGT No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840650_1094840666 17 Left 1094840650 12:34341407-34341429 CCCTGCCACGCATGCGCGGGGTC No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840652_1094840666 12 Left 1094840652 12:34341412-34341434 CCACGCATGCGCGGGGTCCCAGG No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840659_1094840666 -5 Left 1094840659 12:34341429-34341451 CCCAGGGACCGGGGAGTCCCGGG No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840661_1094840666 -6 Left 1094840661 12:34341430-34341452 CCAGGGACCGGGGAGTCCCGGGT No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840643_1094840666 28 Left 1094840643 12:34341396-34341418 CCCCATGACGCCCCTGCCACGCA No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840651_1094840666 16 Left 1094840651 12:34341408-34341430 CCTGCCACGCATGCGCGGGGTCC No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840644_1094840666 27 Left 1094840644 12:34341397-34341419 CCCATGACGCCCCTGCCACGCAT No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data
1094840645_1094840666 26 Left 1094840645 12:34341398-34341420 CCATGACGCCCCTGCCACGCATG No data
Right 1094840666 12:34341447-34341469 CCGGGTTCACGCCCCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094840666 Original CRISPR CCGGGTTCACGCCCCTGGAG TGG Intergenic
No off target data available for this crispr