ID: 1094841200

View in Genome Browser
Species Human (GRCh38)
Location 12:34343342-34343364
Sequence CCGCGCATGCGCAGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094841185_1094841200 -2 Left 1094841185 12:34343321-34343343 CCCCTCCCCCCGCCTCCCCTGCC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841188_1094841200 -7 Left 1094841188 12:34343326-34343348 CCCCCCGCCTCCCCTGCCGCGCA No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841190_1094841200 -9 Left 1094841190 12:34343328-34343350 CCCCGCCTCCCCTGCCGCGCATG No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841184_1094841200 3 Left 1094841184 12:34343316-34343338 CCTGACCCCTCCCCCCGCCTCCC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841186_1094841200 -3 Left 1094841186 12:34343322-34343344 CCCTCCCCCCGCCTCCCCTGCCG No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841187_1094841200 -4 Left 1094841187 12:34343323-34343345 CCTCCCCCCGCCTCCCCTGCCGC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841191_1094841200 -10 Left 1094841191 12:34343329-34343351 CCCGCCTCCCCTGCCGCGCATGC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841182_1094841200 5 Left 1094841182 12:34343314-34343336 CCCCTGACCCCTCCCCCCGCCTC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841183_1094841200 4 Left 1094841183 12:34343315-34343337 CCCTGACCCCTCCCCCCGCCTCC No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data
1094841189_1094841200 -8 Left 1094841189 12:34343327-34343349 CCCCCGCCTCCCCTGCCGCGCAT No data
Right 1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094841200 Original CRISPR CCGCGCATGCGCAGGGTCCC AGG Intergenic
No off target data available for this crispr