ID: 1094841249

View in Genome Browser
Species Human (GRCh38)
Location 12:34343531-34343553
Sequence CCGCGCATGCGCGTGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094841237_1094841249 4 Left 1094841237 12:34343504-34343526 CCCCGGGCCTTCCTCGTGCCACC No data
Right 1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG No data
1094841240_1094841249 -3 Left 1094841240 12:34343511-34343533 CCTTCCTCGTGCCACCCCTGCCG No data
Right 1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG No data
1094841238_1094841249 3 Left 1094841238 12:34343505-34343527 CCCGGGCCTTCCTCGTGCCACCC No data
Right 1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG No data
1094841241_1094841249 -7 Left 1094841241 12:34343515-34343537 CCTCGTGCCACCCCTGCCGCGCA No data
Right 1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG No data
1094841239_1094841249 2 Left 1094841239 12:34343506-34343528 CCGGGCCTTCCTCGTGCCACCCC No data
Right 1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094841249 Original CRISPR CCGCGCATGCGCGTGGTCCA GGG Intergenic
No off target data available for this crispr