ID: 1094841702

View in Genome Browser
Species Human (GRCh38)
Location 12:34345066-34345088
Sequence GTTCCCGCCGCCGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094841702_1094841707 -10 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841707 12:34345079-34345101 CGGCGGGAACCCGGGATCCCGGG No data
1094841702_1094841716 22 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841716 12:34345111-34345133 ATCCTGTGCATGTGTGGCAGAGG No data
1094841702_1094841717 23 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841717 12:34345112-34345134 TCCTGTGCATGTGTGGCAGAGGG No data
1094841702_1094841719 24 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841719 12:34345113-34345135 CCTGTGCATGTGTGGCAGAGGGG No data
1094841702_1094841711 -1 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841711 12:34345088-34345110 CCCGGGATCCCGGGGTGTTTGGG No data
1094841702_1094841708 -9 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841708 12:34345080-34345102 GGCGGGAACCCGGGATCCCGGGG No data
1094841702_1094841715 16 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841715 12:34345105-34345127 TTTGGGATCCTGTGCATGTGTGG No data
1094841702_1094841709 -2 Left 1094841702 12:34345066-34345088 CCAGCAGCTCCGGCGGCGGGAAC No data
Right 1094841709 12:34345087-34345109 ACCCGGGATCCCGGGGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094841702 Original CRISPR GTTCCCGCCGCCGGAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr