ID: 1094841970

View in Genome Browser
Species Human (GRCh38)
Location 12:34346000-34346022
Sequence CCGCGCATGCGCGGGGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094841970_1094841981 -8 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841981 12:34346015-34346037 ATGCGCGGTAGGGGCGGCGAGGG No data
1094841970_1094841985 7 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841985 12:34346030-34346052 GGCGAGGGGTGGCCAGGAGCAGG No data
1094841970_1094841980 -9 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841980 12:34346014-34346036 CATGCGCGGTAGGGGCGGCGAGG No data
1094841970_1094841984 1 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841984 12:34346024-34346046 AGGGGCGGCGAGGGGTGGCCAGG No data
1094841970_1094841982 -7 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841982 12:34346016-34346038 TGCGCGGTAGGGGCGGCGAGGGG No data
1094841970_1094841988 29 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841988 12:34346052-34346074 GTTTTTCTTCCTTCCACCGGTGG No data
1094841970_1094841987 26 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841987 12:34346049-34346071 CAGGTTTTTCTTCCTTCCACCGG No data
1094841970_1094841983 -4 Left 1094841970 12:34346000-34346022 CCCGGGACCCCGCGCATGCGCGG No data
Right 1094841983 12:34346019-34346041 GCGGTAGGGGCGGCGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094841970 Original CRISPR CCGCGCATGCGCGGGGTCCC GGG (reversed) Intergenic
No off target data available for this crispr