ID: 1094842483

View in Genome Browser
Species Human (GRCh38)
Location 12:34347935-34347957
Sequence GAAAGGGGAGGTCGAGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842483_1094842501 28 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
1094842483_1094842503 30 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842503 12:34347988-34348010 GCGAGGTCCACCCGCTCCAGGGG No data
1094842483_1094842490 -2 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842490 12:34347956-34347978 TCAAGTCTCCCTGCCTCTTTGGG No data
1094842483_1094842502 29 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842483_1094842495 13 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842483_1094842491 1 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842491 12:34347959-34347981 AGTCTCCCTGCCTCTTTGGGAGG No data
1094842483_1094842489 -3 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842489 12:34347955-34347977 TTCAAGTCTCCCTGCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842483 Original CRISPR GAAAGGGGAGGTCGAGGCAC TGG (reversed) Intergenic