ID: 1094842484

View in Genome Browser
Species Human (GRCh38)
Location 12:34347941-34347963
Sequence AGACTTGAAAGGGGAGGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842484_1094842502 23 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842484_1094842491 -5 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842491 12:34347959-34347981 AGTCTCCCTGCCTCTTTGGGAGG No data
1094842484_1094842489 -9 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842489 12:34347955-34347977 TTCAAGTCTCCCTGCCTCTTTGG No data
1094842484_1094842490 -8 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842490 12:34347956-34347978 TCAAGTCTCCCTGCCTCTTTGGG No data
1094842484_1094842503 24 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842503 12:34347988-34348010 GCGAGGTCCACCCGCTCCAGGGG No data
1094842484_1094842501 22 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
1094842484_1094842495 7 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842484 Original CRISPR AGACTTGAAAGGGGAGGTCG AGG (reversed) Intergenic