ID: 1094842485

View in Genome Browser
Species Human (GRCh38)
Location 12:34347947-34347969
Sequence GCAGGGAGACTTGAAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842485_1094842507 30 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842485_1094842501 16 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
1094842485_1094842503 18 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842503 12:34347988-34348010 GCGAGGTCCACCCGCTCCAGGGG No data
1094842485_1094842495 1 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842485_1094842502 17 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842485 Original CRISPR GCAGGGAGACTTGAAAGGGG AGG (reversed) Intergenic