ID: 1094842488

View in Genome Browser
Species Human (GRCh38)
Location 12:34347952-34347974
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842488_1094842502 12 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842488_1094842503 13 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842503 12:34347988-34348010 GCGAGGTCCACCCGCTCCAGGGG No data
1094842488_1094842507 25 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842488_1094842495 -4 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842488_1094842501 11 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842488 Original CRISPR AAGAGGCAGGGAGACTTGAA AGG (reversed) Intergenic