ID: 1094842492

View in Genome Browser
Species Human (GRCh38)
Location 12:34347964-34347986
Sequence GGGGGCCTCCCAAAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842492_1094842513 29 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842492_1094842501 -1 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842501 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
1094842492_1094842507 13 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842492_1094842503 1 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842503 12:34347988-34348010 GCGAGGTCCACCCGCTCCAGGGG No data
1094842492_1094842502 0 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842492_1094842515 30 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842492_1094842509 21 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842509 12:34348008-34348030 GGGCCCAAACCCAGGATCACAGG No data
1094842492_1094842510 22 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842492 Original CRISPR GGGGGCCTCCCAAAGAGGCA GGG (reversed) Intergenic