ID: 1094842495

View in Genome Browser
Species Human (GRCh38)
Location 12:34347971-34347993
Sequence TCTTTGGGAGGCCCCCCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842487_1094842495 -3 Left 1094842487 12:34347951-34347973 CCCTTTCAAGTCTCCCTGCCTCT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842488_1094842495 -4 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842481_1094842495 20 Left 1094842481 12:34347928-34347950 CCTTCCACCAGTGCCTCGACCTC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842485_1094842495 1 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842486_1094842495 -2 Left 1094842486 12:34347950-34347972 CCCCTTTCAAGTCTCCCTGCCTC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842483_1094842495 13 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842482_1094842495 16 Left 1094842482 12:34347932-34347954 CCACCAGTGCCTCGACCTCCCCT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data
1094842484_1094842495 7 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842495 12:34347971-34347993 TCTTTGGGAGGCCCCCCGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842495 Original CRISPR TCTTTGGGAGGCCCCCCGCG AGG Intergenic