ID: 1094842496

View in Genome Browser
Species Human (GRCh38)
Location 12:34347982-34348004
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842496_1094842510 4 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG No data
1094842496_1094842507 -5 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842496_1094842519 29 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842496_1094842513 11 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842496_1094842509 3 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842509 12:34348008-34348030 GGGCCCAAACCCAGGATCACAGG No data
1094842496_1094842515 12 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842496 Original CRISPR GAGCGGGTGGACCTCGCGGG GGG (reversed) Intergenic