ID: 1094842500

View in Genome Browser
Species Human (GRCh38)
Location 12:34347986-34348008
Sequence CCTGGAGCGGGTGGACCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842500_1094842513 7 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842500_1094842509 -1 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842509 12:34348008-34348030 GGGCCCAAACCCAGGATCACAGG No data
1094842500_1094842507 -9 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842500_1094842515 8 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842500_1094842519 25 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842500_1094842510 0 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842500 Original CRISPR CCTGGAGCGGGTGGACCTCG CGG (reversed) Intergenic
No off target data available for this crispr