ID: 1094842502

View in Genome Browser
Species Human (GRCh38)
Location 12:34347987-34348009
Sequence CGCGAGGTCCACCCGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842487_1094842502 13 Left 1094842487 12:34347951-34347973 CCCTTTCAAGTCTCCCTGCCTCT No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842493_1094842502 -1 Left 1094842493 12:34347965-34347987 CCTGCCTCTTTGGGAGGCCCCCC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842483_1094842502 29 Left 1094842483 12:34347935-34347957 CCAGTGCCTCGACCTCCCCTTTC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842492_1094842502 0 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842494_1094842502 -5 Left 1094842494 12:34347969-34347991 CCTCTTTGGGAGGCCCCCCGCGA No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842486_1094842502 14 Left 1094842486 12:34347950-34347972 CCCCTTTCAAGTCTCCCTGCCTC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842488_1094842502 12 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842485_1094842502 17 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data
1094842484_1094842502 23 Left 1094842484 12:34347941-34347963 CCTCGACCTCCCCTTTCAAGTCT No data
Right 1094842502 12:34347987-34348009 CGCGAGGTCCACCCGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842502 Original CRISPR CGCGAGGTCCACCCGCTCCA GGG Intergenic
No off target data available for this crispr