ID: 1094842504

View in Genome Browser
Species Human (GRCh38)
Location 12:34347995-34348017
Sequence GTTTGGGCCCCTGGAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842504_1094842521 22 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data
1094842504_1094842513 -2 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842504_1094842523 25 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842504_1094842519 16 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842504_1094842515 -1 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842504_1094842510 -9 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG No data
1094842504_1094842509 -10 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842509 12:34348008-34348030 GGGCCCAAACCCAGGATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842504 Original CRISPR GTTTGGGCCCCTGGAGCGGG TGG (reversed) Intergenic