ID: 1094842505

View in Genome Browser
Species Human (GRCh38)
Location 12:34347998-34348020
Sequence TGGGTTTGGGCCCCTGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842505_1094842523 22 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842505_1094842519 13 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842505_1094842515 -4 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842505_1094842513 -5 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842505_1094842521 19 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842505 Original CRISPR TGGGTTTGGGCCCCTGGAGC GGG (reversed) Intergenic