ID: 1094842506

View in Genome Browser
Species Human (GRCh38)
Location 12:34347999-34348021
Sequence CTGGGTTTGGGCCCCTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842506_1094842523 21 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842506_1094842515 -5 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842506_1094842521 18 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data
1094842506_1094842513 -6 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842513 12:34348016-34348038 ACCCAGGATCACAGGGTCCCCGG No data
1094842506_1094842519 12 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842506_1094842524 30 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842506 Original CRISPR CTGGGTTTGGGCCCCTGGAG CGG (reversed) Intergenic