ID: 1094842507

View in Genome Browser
Species Human (GRCh38)
Location 12:34348000-34348022
Sequence CGCTCCAGGGGCCCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842496_1094842507 -5 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842498_1094842507 -7 Left 1094842498 12:34347984-34348006 CCCCGCGAGGTCCACCCGCTCCA No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842492_1094842507 13 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842500_1094842507 -9 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842494_1094842507 8 Left 1094842494 12:34347969-34347991 CCTCTTTGGGAGGCCCCCCGCGA No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842485_1094842507 30 Left 1094842485 12:34347947-34347969 CCTCCCCTTTCAAGTCTCCCTGC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842487_1094842507 26 Left 1094842487 12:34347951-34347973 CCCTTTCAAGTCTCCCTGCCTCT No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842499_1094842507 -8 Left 1094842499 12:34347985-34348007 CCCGCGAGGTCCACCCGCTCCAG No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842497_1094842507 -6 Left 1094842497 12:34347983-34348005 CCCCCGCGAGGTCCACCCGCTCC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842486_1094842507 27 Left 1094842486 12:34347950-34347972 CCCCTTTCAAGTCTCCCTGCCTC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842493_1094842507 12 Left 1094842493 12:34347965-34347987 CCTGCCTCTTTGGGAGGCCCCCC No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data
1094842488_1094842507 25 Left 1094842488 12:34347952-34347974 CCTTTCAAGTCTCCCTGCCTCTT No data
Right 1094842507 12:34348000-34348022 CGCTCCAGGGGCCCAAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842507 Original CRISPR CGCTCCAGGGGCCCAAACCC AGG Intergenic
No off target data available for this crispr