ID: 1094842508

View in Genome Browser
Species Human (GRCh38)
Location 12:34348004-34348026
Sequence TGATCCTGGGTTTGGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842508_1094842521 13 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data
1094842508_1094842527 30 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842527 12:34348057-34348079 CAGTGGTGGCGTGCGTGGGTGGG No data
1094842508_1094842519 7 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842508_1094842515 -10 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842508_1094842524 25 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842508_1094842523 16 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842508_1094842525 26 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842525 12:34348053-34348075 GTGGCAGTGGTGGCGTGCGTGGG No data
1094842508_1094842526 29 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842526 12:34348056-34348078 GCAGTGGTGGCGTGCGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842508 Original CRISPR TGATCCTGGGTTTGGGCCCC TGG (reversed) Intergenic