ID: 1094842512

View in Genome Browser
Species Human (GRCh38)
Location 12:34348012-34348034
Sequence GGACCCTGTGATCCTGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842512_1094842529 24 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842529 12:34348059-34348081 GTGGTGGCGTGCGTGGGTGGGGG No data
1094842512_1094842523 8 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842512_1094842519 -1 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842512_1094842528 23 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842528 12:34348058-34348080 AGTGGTGGCGTGCGTGGGTGGGG No data
1094842512_1094842524 17 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842512_1094842525 18 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842525 12:34348053-34348075 GTGGCAGTGGTGGCGTGCGTGGG No data
1094842512_1094842526 21 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842526 12:34348056-34348078 GCAGTGGTGGCGTGCGTGGGTGG No data
1094842512_1094842527 22 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842527 12:34348057-34348079 CAGTGGTGGCGTGCGTGGGTGGG No data
1094842512_1094842521 5 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842512 Original CRISPR GGACCCTGTGATCCTGGGTT TGG (reversed) Intergenic