ID: 1094842515

View in Genome Browser
Species Human (GRCh38)
Location 12:34348017-34348039
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842497_1094842515 11 Left 1094842497 12:34347983-34348005 CCCCCGCGAGGTCCACCCGCTCC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842500_1094842515 8 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842506_1094842515 -5 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842492_1094842515 30 Left 1094842492 12:34347964-34347986 CCCTGCCTCTTTGGGAGGCCCCC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842493_1094842515 29 Left 1094842493 12:34347965-34347987 CCTGCCTCTTTGGGAGGCCCCCC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842504_1094842515 -1 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842496_1094842515 12 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842498_1094842515 10 Left 1094842498 12:34347984-34348006 CCCCGCGAGGTCCACCCGCTCCA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842508_1094842515 -10 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842499_1094842515 9 Left 1094842499 12:34347985-34348007 CCCGCGAGGTCCACCCGCTCCAG No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842494_1094842515 25 Left 1094842494 12:34347969-34347991 CCTCTTTGGGAGGCCCCCCGCGA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
1094842505_1094842515 -4 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842515 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842515 Original CRISPR CCCAGGATCACAGGGTCCCC GGG Intergenic