ID: 1094842516

View in Genome Browser
Species Human (GRCh38)
Location 12:34348018-34348040
Sequence TCCCGGGGACCCTGTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842516_1094842529 18 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842529 12:34348059-34348081 GTGGTGGCGTGCGTGGGTGGGGG No data
1094842516_1094842525 12 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842525 12:34348053-34348075 GTGGCAGTGGTGGCGTGCGTGGG No data
1094842516_1094842526 15 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842526 12:34348056-34348078 GCAGTGGTGGCGTGCGTGGGTGG No data
1094842516_1094842531 26 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842531 12:34348067-34348089 GTGCGTGGGTGGGGGTCCATGGG No data
1094842516_1094842519 -7 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842516_1094842521 -1 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842521 12:34348040-34348062 ACACCGTGCATGCGTGGCAGTGG No data
1094842516_1094842530 25 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842530 12:34348066-34348088 CGTGCGTGGGTGGGGGTCCATGG No data
1094842516_1094842528 17 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842528 12:34348058-34348080 AGTGGTGGCGTGCGTGGGTGGGG No data
1094842516_1094842527 16 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842527 12:34348057-34348079 CAGTGGTGGCGTGCGTGGGTGGG No data
1094842516_1094842523 2 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842516_1094842524 11 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842516 Original CRISPR TCCCGGGGACCCTGTGATCC TGG (reversed) Intergenic