ID: 1094842519

View in Genome Browser
Species Human (GRCh38)
Location 12:34348034-34348056
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842500_1094842519 25 Left 1094842500 12:34347986-34348008 CCGCGAGGTCCACCCGCTCCAGG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842505_1094842519 13 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842498_1094842519 27 Left 1094842498 12:34347984-34348006 CCCCGCGAGGTCCACCCGCTCCA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842508_1094842519 7 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842506_1094842519 12 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842516_1094842519 -7 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842512_1094842519 -1 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842514_1094842519 -6 Left 1094842514 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842496_1094842519 29 Left 1094842496 12:34347982-34348004 CCCCCCGCGAGGTCCACCCGCTC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842497_1094842519 28 Left 1094842497 12:34347983-34348005 CCCCCGCGAGGTCCACCCGCTCC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842499_1094842519 26 Left 1094842499 12:34347985-34348007 CCCGCGAGGTCCACCCGCTCCAG No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842511_1094842519 0 Left 1094842511 12:34348011-34348033 CCCAAACCCAGGATCACAGGGTC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
1094842504_1094842519 16 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842519 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842519 Original CRISPR CCCGGGACACCGTGCATGCG TGG Intergenic
No off target data available for this crispr