ID: 1094842523

View in Genome Browser
Species Human (GRCh38)
Location 12:34348043-34348065
Sequence CCGTGCATGCGTGGCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842511_1094842523 9 Left 1094842511 12:34348011-34348033 CCCAAACCCAGGATCACAGGGTC No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842516_1094842523 2 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842504_1094842523 25 Left 1094842504 12:34347995-34348017 CCACCCGCTCCAGGGGCCCAAAC No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842512_1094842523 8 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842508_1094842523 16 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842506_1094842523 21 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842514_1094842523 3 Left 1094842514 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data
1094842505_1094842523 22 Left 1094842505 12:34347998-34348020 CCCGCTCCAGGGGCCCAAACCCA No data
Right 1094842523 12:34348043-34348065 CCGTGCATGCGTGGCAGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842523 Original CRISPR CCGTGCATGCGTGGCAGTGG TGG Intergenic