ID: 1094842524

View in Genome Browser
Species Human (GRCh38)
Location 12:34348052-34348074
Sequence CGTGGCAGTGGTGGCGTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094842517_1094842524 -4 Left 1094842517 12:34348033-34348055 CCCCGGGACACCGTGCATGCGTG No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842508_1094842524 25 Left 1094842508 12:34348004-34348026 CCAGGGGCCCAAACCCAGGATCA No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842511_1094842524 18 Left 1094842511 12:34348011-34348033 CCCAAACCCAGGATCACAGGGTC No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842518_1094842524 -5 Left 1094842518 12:34348034-34348056 CCCGGGACACCGTGCATGCGTGG No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842512_1094842524 17 Left 1094842512 12:34348012-34348034 CCAAACCCAGGATCACAGGGTCC No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842506_1094842524 30 Left 1094842506 12:34347999-34348021 CCGCTCCAGGGGCCCAAACCCAG No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842514_1094842524 12 Left 1094842514 12:34348017-34348039 CCCAGGATCACAGGGTCCCCGGG No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842516_1094842524 11 Left 1094842516 12:34348018-34348040 CCAGGATCACAGGGTCCCCGGGA No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data
1094842520_1094842524 -6 Left 1094842520 12:34348035-34348057 CCGGGACACCGTGCATGCGTGGC No data
Right 1094842524 12:34348052-34348074 CGTGGCAGTGGTGGCGTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094842524 Original CRISPR CGTGGCAGTGGTGGCGTGCG TGG Intergenic