ID: 1094843590

View in Genome Browser
Species Human (GRCh38)
Location 12:34351942-34351964
Sequence CCGTGGGGCCCAGTCACTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094843578_1094843590 8 Left 1094843578 12:34351911-34351933 CCTTTTTCAAGACTACCAGCCTC No data
Right 1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG No data
1094843577_1094843590 17 Left 1094843577 12:34351902-34351924 CCTCGACATCCTTTTTCAAGACT No data
Right 1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG No data
1094843575_1094843590 26 Left 1094843575 12:34351893-34351915 CCACCGGTGCCTCGACATCCTTT No data
Right 1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG No data
1094843580_1094843590 -7 Left 1094843580 12:34351926-34351948 CCAGCCTCTTTGCCCCCCGTGGG No data
Right 1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG No data
1094843576_1094843590 23 Left 1094843576 12:34351896-34351918 CCGGTGCCTCGACATCCTTTTTC No data
Right 1094843590 12:34351942-34351964 CCGTGGGGCCCAGTCACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094843590 Original CRISPR CCGTGGGGCCCAGTCACTCC GGG Intergenic
No off target data available for this crispr