ID: 1094843992

View in Genome Browser
Species Human (GRCh38)
Location 12:34353519-34353541
Sequence ACGTGGGGCCCAGCGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094843992_1094844005 14 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844005 12:34353556-34353578 GGCACTTTCACCTGTGGAAGGGG No data
1094843992_1094843997 -10 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094843997 12:34353532-34353554 GGCCCCACGTATGCGCGGTGGGG No data
1094843992_1094844000 -7 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844000 12:34353535-34353557 CCCACGTATGCGCGGTGGGGAGG No data
1094843992_1094844008 25 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844008 12:34353567-34353589 CTGTGGAAGGGGGACCTCTGCGG No data
1094843992_1094844004 13 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844004 12:34353555-34353577 AGGCACTTTCACCTGTGGAAGGG No data
1094843992_1094844006 15 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844006 12:34353557-34353579 GCACTTTCACCTGTGGAAGGGGG No data
1094843992_1094844003 12 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843992_1094844002 8 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844002 12:34353550-34353572 TGGGGAGGCACTTTCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094843992 Original CRISPR ACGTGGGGCCCAGCGGACTG TGG (reversed) Intergenic
No off target data available for this crispr