ID: 1094844001

View in Genome Browser
Species Human (GRCh38)
Location 12:34353536-34353558
Sequence GCCTCCCCACCGCGCATACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094844001_1094844005 -3 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844005 12:34353556-34353578 GGCACTTTCACCTGTGGAAGGGG No data
1094844001_1094844003 -5 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094844001_1094844006 -2 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844006 12:34353557-34353579 GCACTTTCACCTGTGGAAGGGGG No data
1094844001_1094844008 8 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844008 12:34353567-34353589 CTGTGGAAGGGGGACCTCTGCGG No data
1094844001_1094844002 -9 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844002 12:34353550-34353572 TGGGGAGGCACTTTCACCTGTGG No data
1094844001_1094844004 -4 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844004 12:34353555-34353577 AGGCACTTTCACCTGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094844001 Original CRISPR GCCTCCCCACCGCGCATACG TGG (reversed) Intergenic
No off target data available for this crispr