ID: 1094844003

View in Genome Browser
Species Human (GRCh38)
Location 12:34353554-34353576
Sequence GAGGCACTTTCACCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094844001_1094844003 -5 Left 1094844001 12:34353536-34353558 CCACGTATGCGCGGTGGGGAGGC No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843999_1094844003 -4 Left 1094843999 12:34353535-34353557 CCCACGTATGCGCGGTGGGGAGG No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843993_1094844003 5 Left 1094843993 12:34353526-34353548 CCGCTGGGCCCCACGTATGCGCG No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843991_1094844003 13 Left 1094843991 12:34353518-34353540 CCCACAGTCCGCTGGGCCCCACG No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843992_1094844003 12 Left 1094843992 12:34353519-34353541 CCACAGTCCGCTGGGCCCCACGT No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data
1094843998_1094844003 -3 Left 1094843998 12:34353534-34353556 CCCCACGTATGCGCGGTGGGGAG No data
Right 1094844003 12:34353554-34353576 GAGGCACTTTCACCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094844003 Original CRISPR GAGGCACTTTCACCTGTGGA AGG Intergenic
No off target data available for this crispr