ID: 1094846227

View in Genome Browser
Species Human (GRCh38)
Location 12:34362572-34362594
Sequence CAGGAATGCTTGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094846227_1094846233 0 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846233 12:34362595-34362617 CCGCCTTCAGCTGGCCCCCGTGG No data
1094846227_1094846243 30 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846243 12:34362625-34362647 GCACTCTGTGGGCATGAATGAGG No data
1094846227_1094846242 19 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846242 12:34362614-34362636 GTGGGGCTGATGCACTCTGTGGG No data
1094846227_1094846230 -9 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846230 12:34362586-34362608 GCATTCCTGCCGCCTTCAGCTGG No data
1094846227_1094846234 1 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846234 12:34362596-34362618 CGCCTTCAGCTGGCCCCCGTGGG No data
1094846227_1094846235 2 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846235 12:34362597-34362619 GCCTTCAGCTGGCCCCCGTGGGG No data
1094846227_1094846241 18 Left 1094846227 12:34362572-34362594 CCCTCCTCTTTCAAGCATTCCTG No data
Right 1094846241 12:34362613-34362635 CGTGGGGCTGATGCACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094846227 Original CRISPR CAGGAATGCTTGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr