ID: 1094847844

View in Genome Browser
Species Human (GRCh38)
Location 12:34369185-34369207
Sequence CCGCACATGCGCATGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094847844_1094847853 2 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847853 12:34369210-34369232 GGGAGGTACTTTCGCCCATGGGG No data
1094847844_1094847856 5 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847856 12:34369213-34369235 AGGTACTTTCGCCCATGGGGGGG No data
1094847844_1094847851 0 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847851 12:34369208-34369230 TAGGGAGGTACTTTCGCCCATGG No data
1094847844_1094847854 3 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847854 12:34369211-34369233 GGAGGTACTTTCGCCCATGGGGG No data
1094847844_1094847855 4 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847855 12:34369212-34369234 GAGGTACTTTCGCCCATGGGGGG No data
1094847844_1094847852 1 Left 1094847844 12:34369185-34369207 CCCTGGGCCATGCGCATGTGCGG No data
Right 1094847852 12:34369209-34369231 AGGGAGGTACTTTCGCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094847844 Original CRISPR CCGCACATGCGCATGGCCCA GGG (reversed) Intergenic
No off target data available for this crispr