ID: 1094850865

View in Genome Browser
Species Human (GRCh38)
Location 12:34381780-34381802
Sequence GTGGCAGAGGTCCCCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094850865_1094850870 7 Left 1094850865 12:34381780-34381802 CCCTTGGGGGGGACCTCTGCCAC No data
Right 1094850870 12:34381810-34381832 ATGTTTTCCTTCCACACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094850865 Original CRISPR GTGGCAGAGGTCCCCCCCAA GGG (reversed) Intergenic
No off target data available for this crispr