ID: 1094851094

View in Genome Browser
Species Human (GRCh38)
Location 12:34382719-34382741
Sequence GAAGCAGAGGTGCCCCCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094851094_1094851099 12 Left 1094851094 12:34382719-34382741 CCTGACGGGGGCACCTCTGCTTC No data
Right 1094851099 12:34382754-34382776 CCTTCCACAACACAGGTGACTGG No data
1094851094_1094851097 5 Left 1094851094 12:34382719-34382741 CCTGACGGGGGCACCTCTGCTTC No data
Right 1094851097 12:34382747-34382769 TTGTTTTCCTTCCACAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094851094 Original CRISPR GAAGCAGAGGTGCCCCCGTC AGG (reversed) Intergenic
No off target data available for this crispr