ID: 1094851229

View in Genome Browser
Species Human (GRCh38)
Location 12:34383241-34383263
Sequence TGGGCCCTGCTTATGCCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094851208_1094851229 30 Left 1094851208 12:34383188-34383210 CCCCATGGGCCGAGACTCTCCAT No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data
1094851217_1094851229 11 Left 1094851217 12:34383207-34383229 CCATGGGCACAAACCGGGGATGC No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data
1094851210_1094851229 28 Left 1094851210 12:34383190-34383212 CCATGGGCCGAGACTCTCCATGG No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data
1094851213_1094851229 21 Left 1094851213 12:34383197-34383219 CCGAGACTCTCCATGGGCACAAA No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data
1094851220_1094851229 -2 Left 1094851220 12:34383220-34383242 CCGGGGATGCCCAGGGTCCCCTG No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data
1094851209_1094851229 29 Left 1094851209 12:34383189-34383211 CCCATGGGCCGAGACTCTCCATG No data
Right 1094851229 12:34383241-34383263 TGGGCCCTGCTTATGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094851229 Original CRISPR TGGGCCCTGCTTATGCCCGG TGG Intergenic
No off target data available for this crispr