ID: 1094852697

View in Genome Browser
Species Human (GRCh38)
Location 12:34389361-34389383
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094852693_1094852697 7 Left 1094852693 12:34389331-34389353 CCTGTGGTGTGGAAGGAAAACAC No data
Right 1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094852697 Original CRISPR ATGGCAGAGGTCCCCCCCAA CGG Intergenic
No off target data available for this crispr