ID: 1094855233

View in Genome Browser
Species Human (GRCh38)
Location 12:34399921-34399943
Sequence TTGTTTTCCGTCCACACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094855233_1094855240 27 Left 1094855233 12:34399921-34399943 CCAGAGGTGTGGACGGAAAACAA No data
Right 1094855240 12:34399971-34399993 GACGAAAGTGCCTACCCACTGGG No data
1094855233_1094855234 -8 Left 1094855233 12:34399921-34399943 CCAGAGGTGTGGACGGAAAACAA No data
Right 1094855234 12:34399936-34399958 GAAAACAAACAGTGCATCAGAGG No data
1094855233_1094855235 5 Left 1094855233 12:34399921-34399943 CCAGAGGTGTGGACGGAAAACAA No data
Right 1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG No data
1094855233_1094855239 26 Left 1094855233 12:34399921-34399943 CCAGAGGTGTGGACGGAAAACAA No data
Right 1094855239 12:34399970-34399992 GGACGAAAGTGCCTACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094855233 Original CRISPR TTGTTTTCCGTCCACACCTC TGG (reversed) Intergenic