ID: 1094855235

View in Genome Browser
Species Human (GRCh38)
Location 12:34399949-34399971
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094855233_1094855235 5 Left 1094855233 12:34399921-34399943 CCAGAGGTGTGGACGGAAAACAA No data
Right 1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094855235 Original CRISPR GCATCAGAGGTCCCCTGCAA CGG Intergenic
No off target data available for this crispr