ID: 1094856493

View in Genome Browser
Species Human (GRCh38)
Location 12:34405220-34405242
Sequence CCGCTCATGCGCAGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094856486_1094856493 6 Left 1094856486 12:34405191-34405213 CCCCACTAAAGGGCTGCAGTGTC No data
Right 1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG No data
1094856487_1094856493 5 Left 1094856487 12:34405192-34405214 CCCACTAAAGGGCTGCAGTGTCT No data
Right 1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG No data
1094856485_1094856493 13 Left 1094856485 12:34405184-34405206 CCAAGCTCCCCACTAAAGGGCTG No data
Right 1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG No data
1094856488_1094856493 4 Left 1094856488 12:34405193-34405215 CCACTAAAGGGCTGCAGTGTCTC No data
Right 1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094856493 Original CRISPR CCGCTCATGCGCAGGGCCCC AGG Intergenic
No off target data available for this crispr