ID: 1094863129

View in Genome Browser
Species Human (GRCh38)
Location 12:34493860-34493882
Sequence CAGGATAAAAACAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094863129_1094863134 1 Left 1094863129 12:34493860-34493882 CCTTCCTTCTTGTTTTTATCCTG No data
Right 1094863134 12:34493884-34493906 GTTATTCGATTTTTTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094863129 Original CRISPR CAGGATAAAAACAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr