ID: 1094865968

View in Genome Browser
Species Human (GRCh38)
Location 12:34530355-34530377
Sequence GACAGGGCTTTGAGAGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094865968_1094865972 6 Left 1094865968 12:34530355-34530377 CCAGTTGCTCTCAAAGCCCTGTC No data
Right 1094865972 12:34530384-34530406 TAAGATATTATCAATGACAATGG 0: 4
1: 285
2: 131
3: 58
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094865968 Original CRISPR GACAGGGCTTTGAGAGCAAC TGG (reversed) Intergenic
No off target data available for this crispr