ID: 1094872246

View in Genome Browser
Species Human (GRCh38)
Location 12:34604979-34605001
Sequence GAGGCACGTTCGCCCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094872246_1094872252 -3 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872252 12:34604999-34605021 CTCTCAACTGCTCATGCGTGGGG No data
1094872246_1094872251 -4 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872251 12:34604998-34605020 CCTCTCAACTGCTCATGCGTGGG No data
1094872246_1094872249 -5 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872249 12:34604997-34605019 GCCTCTCAACTGCTCATGCGTGG No data
1094872246_1094872253 3 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872253 12:34605005-34605027 ACTGCTCATGCGTGGGGCCCAGG No data
1094872246_1094872255 5 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872255 12:34605007-34605029 TGCTCATGCGTGGGGCCCAGGGG No data
1094872246_1094872256 12 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872256 12:34605014-34605036 GCGTGGGGCCCAGGGGATCCTGG No data
1094872246_1094872254 4 Left 1094872246 12:34604979-34605001 CCCTCCACGGGCGAACGTGCCTC No data
Right 1094872254 12:34605006-34605028 CTGCTCATGCGTGGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094872246 Original CRISPR GAGGCACGTTCGCCCGTGGA GGG (reversed) Intergenic
No off target data available for this crispr