ID: 1094876655

View in Genome Browser
Species Human (GRCh38)
Location 12:34653678-34653700
Sequence AGTATCTGAGAAGAGATATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1094876652_1094876655 17 Left 1094876652 12:34653638-34653660 CCATTCCTTCTATTGAGCAGCTT No data
Right 1094876655 12:34653678-34653700 AGTATCTGAGAAGAGATATATGG No data
1094876654_1094876655 12 Left 1094876654 12:34653643-34653665 CCTTCTATTGAGCAGCTTGGAAA No data
Right 1094876655 12:34653678-34653700 AGTATCTGAGAAGAGATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1094876655 Original CRISPR AGTATCTGAGAAGAGATATA TGG Intergenic
No off target data available for this crispr