ID: 1095032638

View in Genome Browser
Species Human (GRCh38)
Location 12:37313069-37313091
Sequence AAACTGCTCTATCAAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095032638_1095032640 -3 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032640 12:37313089-37313111 TTTTGAAACACTCCTTTAGAGGG No data
1095032638_1095032639 -4 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032639 12:37313088-37313110 GTTTTGAAACACTCCTTTAGAGG No data
1095032638_1095032643 20 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032643 12:37313112-37313134 ATCTGCTTGTGGATATATGAAGG No data
1095032638_1095032642 9 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032642 12:37313101-37313123 CCTTTAGAGGGATCTGCTTGTGG No data
1095032638_1095032644 29 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032644 12:37313121-37313143 TGGATATATGAAGGTGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095032638 Original CRISPR AAACTGCTCTATCAAAAGAA AGG (reversed) Intergenic