ID: 1095032642

View in Genome Browser
Species Human (GRCh38)
Location 12:37313101-37313123
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095032638_1095032642 9 Left 1095032638 12:37313069-37313091 CCTTTCTTTTGATAGAGCAGTTT No data
Right 1095032642 12:37313101-37313123 CCTTTAGAGGGATCTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095032642 Original CRISPR CCTTTAGAGGGATCTGCTTG TGG Intergenic