ID: 1095034229

View in Genome Browser
Species Human (GRCh38)
Location 12:37338552-37338574
Sequence AGTTCCAAACATCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095034225_1095034229 -6 Left 1095034225 12:37338535-37338557 CCAACGAATTCCCCAAGAGTTCC No data
Right 1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG No data
1095034224_1095034229 0 Left 1095034224 12:37338529-37338551 CCGTTTCCAACGAATTCCCCAAG No data
Right 1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG No data
1095034223_1095034229 1 Left 1095034223 12:37338528-37338550 CCCGTTTCCAACGAATTCCCCAA No data
Right 1095034229 12:37338552-37338574 AGTTCCAAACATCCACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095034229 Original CRISPR AGTTCCAAACATCCACAAGC AGG Intergenic
No off target data available for this crispr