ID: 1095040566

View in Genome Browser
Species Human (GRCh38)
Location 12:37435880-37435902
Sequence GGAAGAGGCCATGCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 13, 1: 2, 2: 2, 3: 39, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040566_1095040575 27 Left 1095040566 12:37435880-37435902 CCTGAGCCTGCATGGCCTCTTCC 0: 13
1: 2
2: 2
3: 39
4: 307
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040566_1095040574 18 Left 1095040566 12:37435880-37435902 CCTGAGCCTGCATGGCCTCTTCC 0: 13
1: 2
2: 2
3: 39
4: 307
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040566 Original CRISPR GGAAGAGGCCATGCAGGCTC AGG (reversed) Intergenic
900599099 1:3495562-3495584 GCAAGGGGCCAGGCAGGCGCTGG + Intronic
901485533 1:9558091-9558113 AGAAGAGGACATGCAGGTTAAGG + Intronic
901663975 1:10816045-10816067 GACAGAGGCCAGGCAGGGTCAGG + Intergenic
901746399 1:11376671-11376693 GGTGGAGGCCTTGGAGGCTCTGG + Intergenic
902161798 1:14536359-14536381 GGATGAGGTCCTGGAGGCTCTGG + Intergenic
903701001 1:25247945-25247967 GGAAGGGTCCAGGGAGGCTCAGG - Intronic
906380098 1:45327214-45327236 CGAAGAGGCGCTGCAGGTTCCGG - Exonic
906948406 1:50315322-50315344 GGAGGAGGCCAGTCAGGGTCAGG + Intergenic
907394071 1:54177462-54177484 GGTAGAGGCCAGGCAGGGTCAGG - Intronic
908050149 1:60220624-60220646 GGAAGCGACCATGCTGACTCAGG + Intergenic
908889667 1:68830244-68830266 GAAAGTGGCCATGCATGCCCAGG + Intergenic
909899040 1:81109689-81109711 TGGAGAGGCAATGCAGACTCTGG - Intergenic
909990646 1:82219416-82219438 GAAAGAGGCAGTGCAGGCTCTGG - Intergenic
910878515 1:91901127-91901149 GGATGAGGACATGGAGGCACTGG - Intronic
912142778 1:106751747-106751769 GGAAGAAGCAATGCAGTGTCTGG + Intergenic
912505593 1:110153474-110153496 GAAAGAAGCCATGCTGGCTCAGG + Intronic
914726860 1:150335144-150335166 GGAAGGGGCAATGGAGACTCGGG - Exonic
915514546 1:156405264-156405286 GGAAGAGGCCATGGGAGCTGTGG - Intronic
915641996 1:157234906-157234928 TTTAGAGGCCATGCAGCCTCTGG + Intergenic
916679794 1:167093972-167093994 GGAGGAAGGAATGCAGGCTCTGG - Intergenic
919177261 1:194034011-194034033 GGAAGAATCCAAGCAGGCTGTGG - Intergenic
919626407 1:199914733-199914755 GAAAGGGGCCAGGCAGGCTGAGG + Intergenic
920184840 1:204152932-204152954 GAGAGAGGCCAGGCCGGCTCAGG + Intergenic
920376677 1:205512529-205512551 GGGGGAGGCCATGCAGGCCAAGG + Intronic
921572141 1:216792569-216792591 GGAAGAATGCATACAGGCTCTGG + Intronic
921991404 1:221371670-221371692 GGAAGGGGCCATGAATGCTCTGG - Intergenic
922068896 1:222171072-222171094 GGAAGGGGCCATGAAGGGTAGGG - Intergenic
922293402 1:224227921-224227943 GGAAAAGCACATGCAGGCGCTGG + Intronic
922949558 1:229547318-229547340 ACAAGAGGCCATGCAGGCAGAGG + Intronic
923114280 1:230919975-230919997 GAAGGAGGCCATGTAGGCTGGGG - Intronic
1062883244 10:995648-995670 GGAAGGGTACATGCAGGGTCGGG + Intronic
1062954360 10:1530294-1530316 GGCAGAGGCCATGCAGGATGAGG - Intronic
1064003372 10:11681811-11681833 GTCGGAGGCCATGCAGGGTCTGG + Intergenic
1065246864 10:23767658-23767680 GGAAGAGGCCGTGAACCCTCAGG + Intronic
1066447422 10:35496402-35496424 GGAAGAGCCCAAGCAGGCCAAGG - Intronic
1066453342 10:35550821-35550843 GGAAGGGGCCCTCCAGTCTCAGG + Intronic
1067151618 10:43739817-43739839 GGGAGAGGCGATGCAGACTTGGG - Intergenic
1067684550 10:48458701-48458723 GGAAGAGGCCTGGCTGGCTGAGG + Intronic
1069743484 10:70700242-70700264 GGACCAGGACATTCAGGCTCAGG - Intronic
1069780545 10:70952706-70952728 GGGAGGGGACATGTAGGCTCTGG + Intergenic
1069799114 10:71071323-71071345 GGAAGGGACCAGGCATGCTCAGG + Intergenic
1069987541 10:72294644-72294666 GGGATAGGCAGTGCAGGCTCTGG + Intergenic
1070280079 10:75042278-75042300 GGAAGGGGCCTGGCAGGCTTCGG - Intronic
1070836792 10:79452507-79452529 GGAAGAGGACTTGCCTGCTCAGG - Intergenic
1072416375 10:95249944-95249966 GGAAGAGGCCAAGCAGGAGTGGG - Intronic
1073176862 10:101562041-101562063 GGGACAGGCCATGGAGGCCCAGG + Intergenic
1073501992 10:103948129-103948151 GGGAGAGGCCATGCAGACAAGGG + Intergenic
1074754717 10:116615766-116615788 AGAAGAGACCAGGCAGGCTTGGG + Intergenic
1075974486 10:126683736-126683758 GGCATGGGCCATGCAGGGTCAGG - Intergenic
1076192945 10:128495670-128495692 GGCATAAGCCATGCAGGCACTGG - Intergenic
1076260894 10:129065151-129065173 GGAAGAAGCCATTCAGGCTGGGG - Intergenic
1076412097 10:130259274-130259296 GGAAGAGGCCAGAGAGGCTTGGG + Intergenic
1076669342 10:132111162-132111184 GGGAGACGCCATGGAAGCTCCGG + Intronic
1077337763 11:2013018-2013040 GGAGAAGGCCAGGCAGGCACAGG - Intergenic
1083682949 11:64359596-64359618 GGAAGTGGGCATGCAAACTCTGG - Intronic
1084020783 11:66416475-66416497 GGAGGAGGCCTTGGAGACTCAGG + Intergenic
1084203489 11:67577391-67577413 GGATGGGGCCATGCAGCCCCAGG + Intergenic
1084551639 11:69846819-69846841 GTAAGAGGCCATGTGGCCTCTGG + Intergenic
1085326098 11:75607690-75607712 GGATGAGGCAAGGCAGGGTCTGG + Intronic
1086079071 11:82884009-82884031 GGAAGAGGCCATCAGTGCTCAGG + Intronic
1086954139 11:92918140-92918162 AGATGAGGTCATGCAGGCACAGG + Intergenic
1087059245 11:93962250-93962272 GGAGGGGGCCCTGCAGGCTGGGG + Intergenic
1087152096 11:94868449-94868471 GGAAGAGGGGATGCTGGCTATGG - Intronic
1090355818 11:126139760-126139782 GGAAGGAGCCATGGAGGCTGAGG - Intergenic
1090405802 11:126475278-126475300 GGAAGTTCCCATGCAGGCTGAGG - Intronic
1202820747 11_KI270721v1_random:68200-68222 GGAGAAGGCCAGGCAGGCACAGG - Intergenic
1095040566 12:37435880-37435902 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1096556309 12:52406155-52406177 GCAAGGGGCCATGCCGGCCCGGG - Exonic
1096684608 12:53279725-53279747 TGACCAGCCCATGCAGGCTCTGG + Exonic
1096820485 12:54230017-54230039 GGAAGAGGGCAAGCAGTCTCAGG + Intergenic
1096898484 12:54849925-54849947 TGCAGAGGACATGAAGGCTCAGG - Intronic
1097173441 12:57129508-57129530 GGCAGAGGGCAGGCAGGCCCGGG + Intronic
1097805598 12:63961434-63961456 AGCAGAGGCCAGGCAGGCCCTGG + Intronic
1098455306 12:70666151-70666173 AGATGAGGACATGAAGGCTCAGG + Intronic
1100088356 12:90938687-90938709 AGAAGAAGCAATGCACGCTCCGG + Intronic
1101631365 12:106498263-106498285 GGAAGAGGCCAGCCTGGCTGCGG + Intronic
1102591439 12:113959452-113959474 GGAAGAGGCAGAGAAGGCTCAGG + Intronic
1104247038 12:127053555-127053577 GGGAGAGCCCATTCCGGCTCAGG - Intergenic
1106505261 13:30365636-30365658 GGGAGAGGTCATGCAGAATCAGG - Intergenic
1106604487 13:31215079-31215101 GAAAGAGGTCAAGCAGTCTCAGG + Exonic
1107146976 13:37070062-37070084 GGGAGAGGCCAGGCAGGAGCAGG - Intergenic
1107700795 13:43045644-43045666 GGTTTAGGCCATGCAGGCTCGGG + Intronic
1110260294 13:73477057-73477079 GGAAAAGGCCACACAGGCGCTGG + Intergenic
1112436466 13:99394365-99394387 GGAGGGGGGCATGCAGGCTCTGG - Intergenic
1112565540 13:100548776-100548798 GGAAGAGGCCTTCCTGGCCCAGG + Intronic
1113535984 13:111066752-111066774 GGAAGAGCCCTTGCAGGCGCGGG + Intergenic
1113630543 13:111880199-111880221 GGAAGAGGACATGCACACACAGG - Intergenic
1113722456 13:112569977-112569999 TGCAGAGCCCAGGCAGGCTCAGG + Intronic
1118819602 14:69336404-69336426 CAAAGAGGCCATGCTGGCTGGGG - Intronic
1119806941 14:77488280-77488302 AGATGAGGCTATGGAGGCTCAGG + Intronic
1121175947 14:91890721-91890743 GGAACAGGCCATCCTGGCACAGG + Intronic
1121193183 14:92047577-92047599 GGAAGAGGCGAAGGAGGCTTTGG + Exonic
1122813943 14:104303147-104303169 GGGGGAGGCTATGCAGGCCCAGG + Intergenic
1122934930 14:104951547-104951569 GGAGGTGGACATGCAGGCCCCGG - Exonic
1123553068 15:21400459-21400481 GGATGCAGCCATGCAGGCTGTGG + Intergenic
1123589313 15:21837847-21837869 GGATGCAGCCATGCAGGCTGTGG + Intergenic
1124624977 15:31302586-31302608 GGCAGAGGACCTGCAGGCTAGGG + Intergenic
1125108591 15:36003954-36003976 GGAAGAAGCAAGGCAGGATCTGG + Intergenic
1125294126 15:38184065-38184087 AGAAGAGGCAATGCAGGATCTGG + Intergenic
1125730619 15:41890852-41890874 GGGAGAAGCCCTGCAGGATCTGG + Intronic
1126065508 15:44823146-44823168 GGATGAGGCCATGAAGCCACTGG - Intergenic
1126094326 15:45077445-45077467 GGATGAGGCCATGAAGCCACTGG + Intergenic
1126150336 15:45518038-45518060 GGAAGAGATCAGGCAGGCCCTGG - Intronic
1126174202 15:45720766-45720788 GAAAGAGGCCAGGCATGCTGTGG + Intergenic
1126915935 15:53466411-53466433 GGAAGAGCCCACACAGGCCCAGG + Intergenic
1127279074 15:57473491-57473513 GCAAGAGGCCCAGAAGGCTCAGG - Intronic
1128621829 15:69157813-69157835 GGAGAAGCCTATGCAGGCTCTGG - Intergenic
1130650774 15:85760904-85760926 GGAAGGGGCCCTGCCAGCTCTGG - Exonic
1131092019 15:89630448-89630470 GGATGAGGCCATCGAGGCCCTGG - Exonic
1131225008 15:90617190-90617212 GGAAGAGGCCAGGAGGGCTTTGG - Intronic
1131377880 15:91940386-91940408 GGAAGAGGGGATCCAGACTCAGG + Intronic
1131825827 15:96322133-96322155 GGCAGAGGCCAGGCAGCCGCGGG - Intergenic
1131921160 15:97330163-97330185 GGAAGAGGCAATGCAGGGAATGG - Intergenic
1132178882 15:99736499-99736521 GGAAGAGCTTATGCTGGCTCAGG + Intergenic
1202961416 15_KI270727v1_random:127679-127701 GGATGCAGCCATGCAGGCTGTGG + Intergenic
1132508099 16:322594-322616 CAAAGAGTCCATGCAGACTCGGG + Intronic
1132986807 16:2771588-2771610 GGGAGTGGACATGCAGGCTATGG + Exonic
1133108018 16:3526385-3526407 GGAAGAGGAAATACAGACTCAGG - Intronic
1134122388 16:11594349-11594371 AGAGGAGGCCAGGCAGGCTATGG + Intronic
1135239041 16:20786981-20787003 GGAAATGGCCAGGCAGGCTTGGG - Intronic
1138026807 16:53528492-53528514 GGCTGAGGCGATGAAGGCTCTGG - Intergenic
1138085698 16:54131963-54131985 GGAAGGGGACTTGCTGGCTCTGG + Intergenic
1139383592 16:66549837-66549859 GGAAGAGGCGCTTCGGGCTCGGG + Intronic
1140410795 16:74739253-74739275 GGCAGAGGGCATGCAGGGTAGGG + Intronic
1141617492 16:85218350-85218372 AGATGAGGCCATGAAGACTCAGG - Intergenic
1141911009 16:87058218-87058240 GGCAGAGGCTTTGCAGGCACGGG - Intergenic
1143109378 17:4544864-4544886 GGATGAGGCCATGATGGCCCTGG - Exonic
1143838557 17:9712428-9712450 GGAAGAGGGTATTCAGGCCCGGG + Intronic
1143978435 17:10847040-10847062 GCTGGAGGCCATGCAGGCTGTGG + Intergenic
1144310715 17:14011740-14011762 AGAAGAGCCCCTGCAGGCTCTGG + Intergenic
1144651592 17:17010707-17010729 TGAAGAGGCCACACAGCCTCCGG - Intergenic
1146539323 17:33680778-33680800 GGAAGTGGCCATGCAGATGCAGG - Intronic
1146590812 17:34126693-34126715 CGAAGAGGCAAGGCAGGCACAGG + Intronic
1147953016 17:44117504-44117526 GGGAGAGTTCATGCCGGCTCTGG + Exonic
1148009050 17:44460481-44460503 AGAATAGGGCATGCAGACTCTGG - Intronic
1149474702 17:56950175-56950197 GGAAGAGGTCGTCCAGGCCCAGG - Exonic
1150636402 17:66916247-66916269 GGGAGAGGAGATGCATGCTCAGG + Intergenic
1150850922 17:68703041-68703063 GGAAGAGGACATGCAGGTAAAGG - Intergenic
1151219002 17:72597867-72597889 GGAAGAGCCCAGGCAGGGTAGGG - Intergenic
1152112819 17:78366469-78366491 CGAGGAGGCCATGCTGTCTCTGG + Intergenic
1152280180 17:79380513-79380535 CCAAGAGGCCAAGGAGGCTCTGG - Intronic
1152446322 17:80346681-80346703 GGCAGACGCCATGCAGGGCCCGG + Exonic
1152549248 17:81021188-81021210 GGAAGAGGCCTTGGAGGCGCCGG + Intergenic
1152622052 17:81369870-81369892 GTCGGAGGCCAGGCAGGCTCTGG - Intergenic
1152736013 17:81997112-81997134 GGATGAGGCCGTGTGGGCTCCGG + Intronic
1152775866 17:82201671-82201693 GGAAGAGGCCAGGCGGGCAGAGG - Exonic
1152809894 17:82376392-82376414 GGGGGAGGCCATGCAGGGTCCGG - Intergenic
1153520378 18:5947151-5947173 GGATTAGGCCATGCAGATTCTGG + Intergenic
1154138344 18:11800679-11800701 GGAAGGGGCCAGGCGGCCTCTGG + Intronic
1154453760 18:14502576-14502598 GGACGCAGCCATGCAGGCTGTGG + Intergenic
1157581912 18:48778612-48778634 GGGAGAGGCCTTCCTGGCTCAGG - Intronic
1160143750 18:76347970-76347992 GGAAGAGGACAGCCGGGCTCAGG - Intergenic
1160823535 19:1068867-1068889 GGAAGAGGCCATGACAGCTAAGG + Intronic
1160904170 19:1444827-1444849 GGGAGAGTCCATGCAGATTCTGG - Intergenic
1160964479 19:1740508-1740530 GGAAGAGGCCAGGCAGGGAACGG - Intergenic
1161156261 19:2733206-2733228 GCGAGAGGCCCTGCACGCTCAGG + Exonic
1161299236 19:3534892-3534914 GGCAGAGTCCATGCAAGCTGAGG - Intronic
1161326678 19:3667596-3667618 GGGAGAGGCTTTGCAGCCTCAGG + Intronic
1161570923 19:5030549-5030571 GGAAGAGGCCATGTGTGCACCGG + Intronic
1162401227 19:10447828-10447850 GGAAGAGGCTGAGCAGGTTCAGG - Intronic
1162948856 19:14058889-14058911 GGCATAGCCGATGCAGGCTCTGG + Intronic
1163025079 19:14506102-14506124 GGAAGACGCCTGGCAGGCCCTGG - Intergenic
1164627813 19:29741099-29741121 TAGAGAGGCCATGCAGGCGCGGG - Intergenic
1165136223 19:33671382-33671404 GGAAGAGGCCAGGCAGAAACAGG - Intronic
1165599029 19:37037175-37037197 GGGAGAGGCCATGCAGGCTCAGG + Intronic
1165717944 19:38058589-38058611 CGAAGTGGCCCTGCAGGTTCTGG + Intronic
1165784430 19:38452897-38452919 TGATGAGGTCCTGCAGGCTCAGG - Exonic
1167256974 19:48436472-48436494 GTTAGGGGCCATGCAGCCTCTGG - Intronic
1167780645 19:51596714-51596736 CGACGAGGCCCTACAGGCTCTGG - Intergenic
1168104044 19:54155855-54155877 GGCAGAGGCCCTGCTGGCCCGGG - Exonic
925717060 2:6794085-6794107 GGAGGAGCTCATGCAGGCCCAGG + Intergenic
925731502 2:6922278-6922300 GGATATGGCCGTGCAGGCTCTGG + Intronic
926138231 2:10352539-10352561 AGCAGAGGCCATGCATGCTGGGG + Intronic
928253437 2:29701436-29701458 GGATGAGGCCTTGCAGCCTCAGG + Intronic
929933403 2:46276103-46276125 GGAGAAGGCCAGGCAGGCTAGGG + Intergenic
930781093 2:55225208-55225230 GGAAGACGCCATGCTGTCTCGGG + Intronic
931720189 2:65061842-65061864 GGCAGAGGCCAAGCAGGCATGGG - Intronic
932489344 2:72110163-72110185 GGGAGAGGCAATGCAGGTGCCGG - Intergenic
933581106 2:84128065-84128087 GGAAGGGGACCTGCTGGCTCTGG - Intergenic
936829610 2:116627257-116627279 GGAAAATGCAATGCAGGCTTTGG + Intergenic
938199143 2:129358615-129358637 TGGAGAGGCCATCCAGGCTTTGG + Intergenic
938261120 2:129895770-129895792 GGATGAGGATATGGAGGCTCAGG - Intergenic
938308182 2:130268505-130268527 AGCAGAGGCCATGCAGGCAGCGG - Intergenic
938772263 2:134510777-134510799 GGAAGAGGCCTCTCAGGCTCAGG - Intronic
942607931 2:177711645-177711667 GGCCAAGGCCATGCAGGCTTGGG - Intronic
946171317 2:217897684-217897706 AGAAGAGGGCATGCTGGCACAGG + Intronic
946235514 2:218322525-218322547 GGAAGAGGCCACACAAGCTCTGG - Intronic
946432360 2:219632463-219632485 TGAAGAGGGCTTGCAGCCTCGGG - Intronic
946982884 2:225237298-225237320 GGAAGAGTCCATGGAGACTAGGG - Intergenic
947624565 2:231611678-231611700 GGCTGAGGGCAGGCAGGCTCTGG + Intergenic
947840560 2:233204944-233204966 TGCAGAGGCAATGCAGGGTCAGG - Intronic
947877925 2:233480172-233480194 GGCAGAGGGCATGCAGTCCCTGG + Intronic
947968605 2:234302835-234302857 GGAAGAGGGCTTGGAGGCTCTGG - Intergenic
948185637 2:236019351-236019373 GGAAGAGGCCCTGGATGCTCTGG + Intronic
948641202 2:239377074-239377096 GGCAGAGGCCCCGCAGGCTGGGG - Intronic
948745415 2:240089330-240089352 AGAAGAGGCCAGGCAGGTTAGGG + Intergenic
948766884 2:240226973-240226995 GGGACAGGGAATGCAGGCTCAGG + Intergenic
948883215 2:240870748-240870770 GGGAGTGGGCATGCTGGCTCAGG + Intronic
948931200 2:241133499-241133521 GGAAGAGGGCATGCAGTCTTAGG - Intronic
948975646 2:241461859-241461881 GGGAGAGGCCCTGCAGGGACAGG + Intronic
1168767214 20:389690-389712 GGAATAACCCAAGCAGGCTCAGG + Intronic
1168810930 20:704132-704154 GGAAGAGGCAAAGAATGCTCTGG + Intergenic
1171201378 20:23244934-23244956 GGGAGGGGTCATGCAGGGTCTGG - Intergenic
1171526229 20:25813627-25813649 GGAAGAGGCCATGCAGGCTCAGG - Intronic
1171535113 20:25880491-25880513 GAAAGAGGCCATGCAGGGTCAGG - Intergenic
1171550598 20:26042258-26042280 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1171572754 20:26269405-26269427 GGAAGAGGCCATGCGGGCTCAGG + Intergenic
1171805938 20:29680399-29680421 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1171838124 20:30176035-30176057 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1172396349 20:34608777-34608799 GCAAGTGGCCATTCAGCCTCTGG + Intronic
1172944523 20:38676907-38676929 GGATGAGGCCAGGCCAGCTCAGG + Intergenic
1173560884 20:44004519-44004541 GCAAGGGGCCATGTGGGCTCTGG + Intronic
1173763670 20:45587062-45587084 GGAAGAGGCAAAGGAGGCTTTGG + Intergenic
1174369560 20:50077482-50077504 GCAAGAGGCCAGGCAGGGGCCGG + Intergenic
1175553369 20:59831268-59831290 GGAAGAGGCTGGGCAGGCCCTGG - Intronic
1176033596 20:63025631-63025653 GGAAGAGGCCGTGCTGCGTCCGG + Intergenic
1176074768 20:63243438-63243460 GGCAGACGCCAAGCAGGGTCTGG - Intronic
1176083231 20:63284440-63284462 GGAAGAGGGCACGGAGGCTGGGG - Intronic
1179681461 21:43024243-43024265 GGAAATGGCCAGGCAGGCTGGGG - Intronic
1180016827 21:45092248-45092270 GAAGGCTGCCATGCAGGCTCAGG - Intronic
1180068482 21:45424504-45424526 GGAGGTGACCACGCAGGCTCAGG - Intronic
1180160117 21:45995390-45995412 GGAAGAGGCCATGCAGCCAGTGG + Intronic
1180574513 22:16760081-16760103 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1180929536 22:19579464-19579486 GGCAGAGGCCTTGCAGGCACTGG - Intergenic
1183102907 22:35594746-35594768 GGAAGAGGCAGACCAGGCTCAGG + Intergenic
1183327061 22:37199984-37200006 GGGAGACACCAGGCAGGCTCTGG + Intergenic
1183392199 22:37552097-37552119 GGAGGAGGCCATGCAGGAGATGG + Intergenic
1184017248 22:41795515-41795537 GGAAGAAGCCATGCAGGGCCTGG - Exonic
1184171708 22:42764057-42764079 GGAGGTGGCCCTGCAGGCTGGGG + Intergenic
1184173910 22:42775228-42775250 GGAGGAGGCCCTGGAGGCCCTGG - Intergenic
1184255460 22:43284278-43284300 GAAAGAGGCCAAGCCGACTCAGG + Intronic
1184448942 22:44571391-44571413 GGATGAGGAAATGGAGGCTCGGG + Intergenic
1184601087 22:45543758-45543780 GGCAGAGGCCATGCGGGATGTGG + Intronic
1184658797 22:45955835-45955857 GGACAAGGCCCTGCAGTCTCAGG + Intronic
1185280749 22:49968877-49968899 ATAAGGGGCCAAGCAGGCTCAGG + Intergenic
950257829 3:11520541-11520563 GGAAGATGCCGTGCTGGCCCTGG + Intronic
950638099 3:14330310-14330332 GGAAGAGGTGATGCAGGCAGAGG - Intergenic
950835762 3:15917745-15917767 GGAAGAGGGCATTAAGGCCCTGG + Intergenic
952532167 3:34273957-34273979 GGGAGAGGCTAAGCAGTCTCTGG + Intergenic
952763399 3:36934979-36935001 TGAAGAGGCCATGCTGGAGCTGG - Intronic
953031200 3:39180983-39181005 GGAACACGCCCTGCGGGCTCCGG + Intergenic
953223494 3:40996495-40996517 GGCAGAGTCCCTGCTGGCTCAGG + Intergenic
953732862 3:45465024-45465046 GCCAGAGCCCATGCCGGCTCTGG + Intronic
954432844 3:50480503-50480525 AGAAGAGGCCTAGCAGGCTGAGG + Intronic
954458045 3:50610681-50610703 GGAAGAGGACATGGAGGTGCTGG - Intronic
955198772 3:56830641-56830663 GGATGAGGCCCTGCGGGATCTGG + Intronic
955999214 3:64710913-64710935 AGATGAGGCTATGGAGGCTCAGG - Intergenic
956467850 3:69536501-69536523 GGTAGAGGCGCTGCAGGCTGGGG - Intronic
957875541 3:86141171-86141193 GAAACAGGCTATGCACGCTCAGG + Intergenic
960949487 3:122989891-122989913 GGCAGAGACCATGAAGACTCAGG + Intronic
963063451 3:141243155-141243177 AGACCAGGCCAGGCAGGCTCTGG - Intronic
963232849 3:142926493-142926515 GGAAAAGGGTAGGCAGGCTCTGG - Intergenic
963273604 3:143308834-143308856 GGAAGAGGCCAAGCAAGCCAGGG - Intronic
964345946 3:155754916-155754938 TGAAGAGGCCATGGAGGATAAGG + Intergenic
965149674 3:164954092-164954114 GGAAGAGGGCATGAAGTCACTGG - Intergenic
965599611 3:170442046-170442068 GGAAGGGGCCTTGTAGGATCTGG + Intronic
967411401 3:189169796-189169818 GGAAGAGGCAATCAAGGCTTGGG + Intronic
969132753 4:5003758-5003780 AGACGAGGCCATGCTGGCTGGGG + Intergenic
970439154 4:16065191-16065213 GGCATATGGCATGCAGGCTCTGG - Intronic
971444689 4:26730862-26730884 CAAAGAGAACATGCAGGCTCTGG + Intronic
973581945 4:52352628-52352650 AGAAGAGCTCATGCAGGCTCTGG - Intergenic
973784542 4:54322892-54322914 GGGAGAGCCCACCCAGGCTCAGG + Intergenic
975849796 4:78560470-78560492 GGGAGAGGGCATGGAGGCTCTGG - Intronic
977171519 4:93768201-93768223 GGAATAGGCCTGGCAGGCCCTGG + Intronic
983561043 4:169101801-169101823 GGCAGAGGCCATTCAGGGACCGG - Intronic
984898568 4:184564068-184564090 GGAAGAGGCGGTGCAGGCTCAGG + Intergenic
985114433 4:186577006-186577028 GGAAGAGCCCACACAGCCTCCGG + Intergenic
985754412 5:1704592-1704614 GGACGAGGCCTTGCTGGCACAGG + Intergenic
986730026 5:10628569-10628591 CGAAGAGGCCAGGGAGGCTGAGG - Intronic
987725960 5:21699856-21699878 GGAGGTGGCCAGCCAGGCTCTGG + Intergenic
988614909 5:32765957-32765979 GCCACAGGCCTTGCAGGCTCTGG - Intronic
990906314 5:60807049-60807071 GGAAGAGGCCATGTTGGGTTAGG - Intronic
995650334 5:114362024-114362046 GGAAGGGCCCATGCCGGCTCCGG - Exonic
997828829 5:137131640-137131662 TGAGGAGGCCACACAGGCTCTGG + Intronic
998161192 5:139813848-139813870 TGAAGAGGGCATGCTGACTCTGG - Intronic
998988526 5:147789269-147789291 GGAAGAGGCCAAGCTAGCTGTGG - Intergenic
999147840 5:149407541-149407563 GGAAGAGGCAATGTAAGCTCAGG + Intergenic
999323224 5:150627247-150627269 TGGTGAGGCCCTGCAGGCTCTGG + Intronic
1000343782 5:160297381-160297403 GGAAGAAGCCAAGCAGTCACTGG - Intronic
1001148140 5:169202915-169202937 GTCAGAGGCAAGGCAGGCTCAGG - Intronic
1001449844 5:171816188-171816210 GGAATAGGCGGTGCAGGCTGAGG - Intergenic
1001970178 5:175949146-175949168 CAAAGAGTCCAGGCAGGCTCAGG - Intronic
1002247260 5:177894618-177894640 CAAAGAGTCCAGGCAGGCTCAGG + Intergenic
1003399068 6:5776609-5776631 GGTTGAGGAAATGCAGGCTCAGG - Intergenic
1003979826 6:11379120-11379142 GGCACAGGCCAGGCAGGCCCTGG + Intronic
1004205828 6:13591498-13591520 GGCAGATGCCAGGCAGGGTCTGG - Intronic
1004902807 6:20209809-20209831 GGAGGAGCCCCTGCAGGCTGAGG + Intronic
1005311571 6:24564162-24564184 GGAGCTGGCCATGCAGGCTCTGG - Intronic
1006847554 6:37073141-37073163 AGAGGAGGACATGAAGGCTCAGG + Intergenic
1007634220 6:43288125-43288147 GGCAGAGGCCATGCAGTGACTGG - Exonic
1007693445 6:43717360-43717382 GGAAGAGGCCATTACTGCTCTGG + Intergenic
1008685508 6:53921905-53921927 GGAAGAGGCAATGAAGTCACTGG - Intronic
1016251289 6:142045999-142046021 GGAAGAGGGCATATAGGATCTGG + Intergenic
1017171972 6:151465421-151465443 GGAAGGGTCCATGGAGGCTGAGG + Intronic
1017939158 6:159036213-159036235 TGAAGAGGCCATGCAGGGCCCGG - Exonic
1017947771 6:159109655-159109677 GGAATGGGCCAGGCATGCTCAGG + Intergenic
1019649404 7:2148582-2148604 GTGAGGGGCCATCCAGGCTCCGG - Intronic
1022423960 7:30249786-30249808 GGAAGAGATAATGCTGGCTCGGG + Intergenic
1022453133 7:30534301-30534323 GGAAGACCCCAGGCAGGGTCAGG - Intronic
1023838465 7:44082135-44082157 AGAAGAGGAGATGGAGGCTCAGG + Intronic
1025286615 7:57667514-57667536 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1025299450 7:57806513-57806535 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1025624192 7:63204181-63204203 TGAAGAGGCCACACATGCTCTGG + Intergenic
1026031799 7:66800779-66800801 GAAAGAGGCCAGGAAGGCTGGGG - Intronic
1027226729 7:76248316-76248338 GGGAGAGGGGGTGCAGGCTCAGG + Intronic
1027232306 7:76279906-76279928 AGAAGAGGCCACGCCGCCTCTGG - Intronic
1029442792 7:100596502-100596524 GGAAGAGTCACTGCAGGTTCTGG + Intronic
1032096373 7:128940291-128940313 GGCTGAGGCCGTGCAGGCGCTGG - Intronic
1032390271 7:131551398-131551420 GAAAGTGTCCAGGCAGGCTCAGG + Intronic
1033158232 7:138974338-138974360 GAAAGAGGGCAGGGAGGCTCAGG + Intronic
1033681711 7:143601533-143601555 GGATGAGGTGATGCAGGCTGTGG + Intergenic
1033703180 7:143860280-143860302 GGATGAGGTGATGCAGGCTGTGG - Exonic
1035300191 7:157891977-157891999 AGCAGAGCCCCTGCAGGCTCAGG - Intronic
1035620234 8:1031065-1031087 CGCAGACGCCAGGCAGGCTCTGG - Intergenic
1037785466 8:21900400-21900422 GCACAAGGCCATACAGGCTCAGG - Intergenic
1037964175 8:23120371-23120393 GGAAGAGGCAGGGCAGGGTCAGG + Intergenic
1037976582 8:23218242-23218264 GGAAGAGGCAGGGCAGGGTCAGG - Intronic
1039907942 8:41799784-41799806 GGAAAAGGCCAGGCATGCTCAGG + Intronic
1041721046 8:60975572-60975594 GGAAGAGGCAAGGCAGTATCTGG + Intergenic
1043662179 8:82757976-82757998 GGCAGAGGCCATGCTGGCTGTGG - Intergenic
1043909346 8:85842730-85842752 GGAAGTGGCCCTGCAGGCGCTGG + Intergenic
1044572586 8:93736115-93736137 GGAAGAGGGCGTCCAGGATCTGG - Exonic
1045438979 8:102191209-102191231 GGAAGAATCCAAGCAGGCTGTGG - Intergenic
1047283957 8:123470425-123470447 GGATGAGGCCCTACAGGCTGAGG + Intergenic
1047557304 8:125946352-125946374 AGAAGAGGTAATCCAGGCTCTGG - Intergenic
1048443792 8:134478520-134478542 GCAGGAGGCCATGCAGCCTGTGG - Exonic
1048465385 8:134661198-134661220 GGCAGGAGACATGCAGGCTCAGG + Intronic
1049157944 8:141078355-141078377 AGAAGAGGCCATGCTGGATTAGG - Intergenic
1049820842 8:144632353-144632375 GGAAGAGGGGCTGCAGGCTCTGG - Intergenic
1051532360 9:18119000-18119022 TGAAGGGGCCAAGCTGGCTCTGG - Intergenic
1053794130 9:41709517-41709539 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1054151036 9:61605310-61605332 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1054182538 9:61921556-61921578 GGAAGAGGCCATGCAGGCTCAGG - Intergenic
1054470822 9:65536422-65536444 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1054655970 9:67666923-67666945 GGAAGAGGCCATGCAGGCTCAGG + Intergenic
1054729580 9:68687112-68687134 GGAAGTGGCTTTGCAGGCTGGGG - Intergenic
1055994495 9:82142643-82142665 GGAAGAGGACATGCACGATGAGG - Intergenic
1056589079 9:87951264-87951286 GGCAGAGTCCAAGCAGGCTGTGG + Intergenic
1056591835 9:87970637-87970659 GGAAGAGGGCTGGCAGGCACTGG + Intronic
1056670506 9:88623685-88623707 GGAAGAATCCAAGCAGGCTAAGG - Intergenic
1056843094 9:90014525-90014547 TGAAGAGGCATTGCAGGTTCTGG + Intergenic
1058720772 9:107761487-107761509 GGGAGAGGCTGAGCAGGCTCCGG + Intergenic
1059354754 9:113689935-113689957 GGAAGAGGCAAGCTAGGCTCAGG + Intergenic
1060601554 9:124881588-124881610 GGGAGAGGCCGTGCAGGAACTGG - Intronic
1060722048 9:125986040-125986062 GGCAGGAGCCATCCAGGCTCGGG - Intergenic
1061131408 9:128710428-128710450 AGAAGAGGAAATGCAGGCTCTGG + Intronic
1061862549 9:133475471-133475493 CGAAGAGGCCCTGCGGGCGCTGG - Exonic
1062083333 9:134636053-134636075 GGAAGAACCCAGGCAGGCTGTGG - Intergenic
1062596816 9:137303290-137303312 GCAGGAGGCCAGGCAGGCTGGGG + Intergenic
1203526950 Un_GL000213v1:98831-98853 GGACGCAGCCATGCAGGCTGTGG + Intergenic
1187142516 X:16607448-16607470 GGAGCAGGCCATGGGGGCTCTGG - Intronic
1187224342 X:17361511-17361533 GGAAGAAGTCCTGCAGGCTCAGG - Intergenic
1187388856 X:18872809-18872831 GGCAGAGCCCAGTCAGGCTCCGG + Intergenic
1187973009 X:24677191-24677213 GGAAGAGGCCAAACAGGCCCTGG - Intergenic
1188286326 X:28329175-28329197 TGGAGGGGCCATGCAGCCTCTGG - Intergenic
1190527067 X:51338929-51338951 GGCAGAGGCCATACAGCCTCTGG - Intergenic
1191225707 X:58040666-58040688 AGAGGAGGCCATGCAGGATGGGG - Intergenic
1191710797 X:64148502-64148524 AGATGAGGCCATGAAGGCTCAGG - Intergenic
1193278298 X:79617578-79617600 GGAAGTGGCCAGGTAGGCTATGG - Intergenic
1193306725 X:79959634-79959656 GCAAGCGGCCTTGGAGGCTCTGG + Intergenic
1196319055 X:114267241-114267263 GGAATAGTACATGCAGGATCAGG + Intergenic
1197638923 X:128946960-128946982 GGAAGAGAACATGGAGGCTGAGG - Intergenic
1201237310 Y:11923605-11923627 GGAAGAAGGCATGCAAGCTTGGG - Intergenic