ID: 1095040569

View in Genome Browser
Species Human (GRCh38)
Location 12:37435886-37435908
Sequence ACCCAGGGAAGAGGCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040569_1095040575 21 Left 1095040569 12:37435886-37435908 CCTGCATGGCCTCTTCCCTGGGT No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040569_1095040574 12 Left 1095040569 12:37435886-37435908 CCTGCATGGCCTCTTCCCTGGGT No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040569 Original CRISPR ACCCAGGGAAGAGGCCATGC AGG (reversed) Intergenic
No off target data available for this crispr