ID: 1095040571

View in Genome Browser
Species Human (GRCh38)
Location 12:37435901-37435923
Sequence TGCATTTTGAAATGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040571_1095040581 24 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040581 12:37435948-37435970 CAAGGCTCTGCTGTCTGAAGGGG No data
1095040571_1095040578 22 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040578 12:37435946-37435968 CCCAAGGCTCTGCTGTCTGAAGG No data
1095040571_1095040575 6 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040571_1095040580 23 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040580 12:37435947-37435969 CCAAGGCTCTGCTGTCTGAAGGG No data
1095040571_1095040574 -3 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040571 Original CRISPR TGCATTTTGAAATGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr