ID: 1095040574

View in Genome Browser
Species Human (GRCh38)
Location 12:37435921-37435943
Sequence GCAAACTGTGTTTGTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040566_1095040574 18 Left 1095040566 12:37435880-37435902 CCTGAGCCTGCATGGCCTCTTCC 0: 13
1: 2
2: 2
3: 39
4: 307
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data
1095040569_1095040574 12 Left 1095040569 12:37435886-37435908 CCTGCATGGCCTCTTCCCTGGGT No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data
1095040571_1095040574 -3 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data
1095040572_1095040574 -4 Left 1095040572 12:37435902-37435924 CCTGGGTCCATTTCAAAATGCAA No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data
1095040570_1095040574 3 Left 1095040570 12:37435895-37435917 CCTCTTCCCTGGGTCCATTTCAA No data
Right 1095040574 12:37435921-37435943 GCAAACTGTGTTTGTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040574 Original CRISPR GCAAACTGTGTTTGTCCAAA TGG Intergenic
No off target data available for this crispr