ID: 1095040575

View in Genome Browser
Species Human (GRCh38)
Location 12:37435930-37435952
Sequence GTTTGTCCAAATGGTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095040569_1095040575 21 Left 1095040569 12:37435886-37435908 CCTGCATGGCCTCTTCCCTGGGT No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040572_1095040575 5 Left 1095040572 12:37435902-37435924 CCTGGGTCCATTTCAAAATGCAA No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040571_1095040575 6 Left 1095040571 12:37435901-37435923 CCCTGGGTCCATTTCAAAATGCA No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040573_1095040575 -2 Left 1095040573 12:37435909-37435931 CCATTTCAAAATGCAAACTGTGT No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040570_1095040575 12 Left 1095040570 12:37435895-37435917 CCTCTTCCCTGGGTCCATTTCAA No data
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data
1095040566_1095040575 27 Left 1095040566 12:37435880-37435902 CCTGAGCCTGCATGGCCTCTTCC 0: 13
1: 2
2: 2
3: 39
4: 307
Right 1095040575 12:37435930-37435952 GTTTGTCCAAATGGTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095040575 Original CRISPR GTTTGTCCAAATGGTGCCCA AGG Intergenic
No off target data available for this crispr